View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_280 (Length: 229)
Name: NF1345_low_280
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_280 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] scaffold0291 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 7906862 - 7907084
Alignment:
| Q |
7 |
gctgctaccatagctgtcttgttggtttttgaatttgatcaatgtacaaagttgattcttttaagacattgcatctatgcttcaagacaaactctaaggt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7906862 |
gctgctaccatagctgtcttgttggtttttgaatttgatcaatgtacaaagttgattcttttaagtcattgcatctatgcttcaagacaaactctaaggt |
7906961 |
T |
 |
| Q |
107 |
gaatcctacttggaaatttaagttcattatgtccatcactatcgagaatcagaaactcacgtttaggcttacatgtgacggtgacatcaacttggagaaa |
206 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7906962 |
gaatcctacttggaaatttaagtacattatgtccatcactatcgagaatcagaaactcacgtttaggcttacgtgtgacggtgacatcaacttggagaaa |
7907061 |
T |
 |
| Q |
207 |
ccacaatgtcacttaacacatca |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7907062 |
ccacaatgtcacttaacacatca |
7907084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 86 - 135
Target Start/End: Original strand, 3901 - 3950
Alignment:
| Q |
86 |
cttcaagacaaactctaaggtgaatcctacttggaaatttaagttcatta |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3901 |
cttcaagacaaactctaaggtgaatcctacttgagaatttaagttcatta |
3950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University