View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1345_low_285 (Length: 224)

Name: NF1345_low_285
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1345_low_285
NF1345_low_285
[»] chr1 (1 HSPs)
chr1 (1-126)||(8716477-8716608)


Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 8716477 - 8716608
Alignment:
1 tcaagtggctgctggacgaagacaaaggattctcgttcaaaacctgctatagtcttctgcttgaccttcacttttctgc------tgatgcaaaattttt 94  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||      |||||||||||||||    
8716477 tcaagtggctgctggacgaagacaacggattctcgttcaaaacctgctatagtctgctgcttgatcttcacttttctgctgatgatgatgcaaaattttt 8716576  T
95 gacagcagctcggagttttgtgggacacatca 126  Q
    ||||||||||||||||||||||||||||||||    
8716577 gacagcagctcggagttttgtgggacacatca 8716608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University