View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_299 (Length: 205)
Name: NF1345_low_299
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_299 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 85 - 205
Target Start/End: Complemental strand, 26751659 - 26751539
Alignment:
| Q |
85 |
caacaatatagcagtggaatggtttgtgagaggaatggagtggtaaagcttgacagagaatacatgaaaaagaaagaaaatggttcattgaagttcatgc |
184 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26751659 |
caacaaaatagcagtggaatggtttgtgagaggaatggagtggtaaagcttgacagagaatacatgaagaagaaagaaaatggttcattgaagttcatgc |
26751560 |
T |
|
| Q |
185 |
tttggtttgcttgtggattag |
205 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26751559 |
tttggtttgcttgtggattag |
26751539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Complemental strand, 26734429 - 26734393
Alignment:
| Q |
157 |
aaagaaaatggttcattgaagttcatgctttggtttg |
193 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
26734429 |
aaagaaaatggatcagtgaagttcatgctttggtttg |
26734393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University