View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_39 (Length: 543)
Name: NF1345_low_39
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 3e-86; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 150 - 311
Target Start/End: Complemental strand, 33985987 - 33985826
Alignment:
| Q |
150 |
aaacatatacaacttagttaagcaaaacagatccaatgtctttgaagacgaaatatttgccaaactctactactcactcaatcgacgcaaacatcaaggc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33985987 |
aaacatatacaacttagttaagcaaaacagatccaatgtctttgaagacgaaatatttgccaaactctactactcactcaatcgacgcaaacatcaaggc |
33985888 |
T |
 |
| Q |
250 |
tgcactttaggtatattgttgctttcatttttcatctacaacatttcttatgaatttacttg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33985887 |
tgcactttaggtatattgttgctttcatttttcatctacaacatttcttatgaatttacttg |
33985826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 465 - 543
Target Start/End: Complemental strand, 33985687 - 33985609
Alignment:
| Q |
465 |
tttctctcttctccgattgcaggtatgtgtgtgtattttgattttgtttttcaatcaattctattattgtgatcgtgtg |
543 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33985687 |
tttctctcttctccgattgcaggtatgtgtgtgtattttgattttgtttttcaatcaattctattattgtgatcgtgtg |
33985609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 421 - 450
Target Start/End: Complemental strand, 33985715 - 33985686
Alignment:
| Q |
421 |
tttgacattcccttctctgcgattgcgatt |
450 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33985715 |
tttgacattcccttctctgcgattgcgatt |
33985686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University