View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_98 (Length: 425)
Name: NF1345_low_98
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_98 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 3e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 121 - 249
Target Start/End: Original strand, 50632290 - 50632421
Alignment:
| Q |
121 |
cacacaagttgatgttttcttcattttctctttcaactagaattcaagagt---gtgtttgtttttgttgaatgaatgaatgaccaatgttttcacttgg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50632290 |
cacacaagttgatgttttcttcattttctctttcaactacaattcaagagtagtgtgtttgtttttgtggaatgaatgaatgaccaatgttttcacttgg |
50632389 |
T |
|
| Q |
218 |
ctgctatttaaggtagtttggtcggtgagcta |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
50632390 |
ctgctatttaaggtagtttggtcggtgagcta |
50632421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 324 - 419
Target Start/End: Original strand, 50632529 - 50632624
Alignment:
| Q |
324 |
attattgttgtcacatgtaagttgtttgttgctttttgtaaccatgggctttgagtcgacatagtgattttaaggttaaaccccctttcatgtcac |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50632529 |
attattgttgtcacatgtaagttgtttgttgctttttgtaaccatgggctttgagtcgacatagtgattttaaggttaaaccccctttcatgtcac |
50632624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University