View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13460_high_11 (Length: 250)
Name: NF13460_high_11
Description: NF13460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13460_high_11 |
 |  |
|
| [»] scaffold1118 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1118 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: scaffold1118
Description:
Target: scaffold1118; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 1256 - 1027
Alignment:
| Q |
1 |
cattagcatgtaattaggtgttgtgtatctaatgcgtatcactataagtaccctttgtattatgattttatgtatgagaaatgagtttgtattctatctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1256 |
cattagcatgtaattaggtgttgtgtatctaatgcgtatcactataagtaccctttgtattatgattttatgtatgagaaatgagtttgtattctatctt |
1157 |
T |
 |
| Q |
101 |
ttaattcccataacatggtatcattgggcctctctcatttccacggagaaagttcgttagaagttagttacaaattcattcttcatccattttccttgaa |
200 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1156 |
ttaattcccatgacatggtatcattgagcctctctcatttccacggagaaagttcgttagaagttagttacaaattcattcttcatcaattttccttgaa |
1057 |
T |
 |
| Q |
201 |
tcttcatcgtttttccttgaacgttggtca |
230 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
1056 |
tcttcatcgtttttccttgaacgttcgtca |
1027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University