View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13460_high_12 (Length: 234)
Name: NF13460_high_12
Description: NF13460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13460_high_12 |
 |  |
|
| [»] scaffold0458 (1 HSPs) |
 |  |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0743 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 10)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 1488603 - 1488455
Alignment:
| Q |
1 |
gctaaaatataagacacaagttcacaataacaacgccattgcccattgatagctaatagtggcaataaaagtatttgttttatcgtatccacagagactt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1488603 |
gctaaaatataagacacaagttcccaacaacaacgccattg-------atagctaatagtggcaataaaagtatttgttttatcgtatccacagagactt |
1488511 |
T |
 |
| Q |
101 |
gcggtacatttttgccgttcagctatttatattatcttaagtagggttgaataagg |
156 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1488510 |
gcggtacatttttgctgttcagctacttatattatcttaagtagggttgaataagg |
1488455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 32559378 - 32559327
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
32559378 |
ttggtggtggccgggatttgaaccccagaccttacata-ttttatgcattgtc |
32559327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 6489081 - 6489030
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| | |||||||||||| |
|
|
| T |
6489081 |
ttggtggtggccggggtttgaaccccagaccttgcata-tattatgcattgtc |
6489030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 220
Target Start/End: Complemental strand, 1488433 - 1488387
Alignment:
| Q |
174 |
gtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
1488433 |
gtggccgggatttgaaccccgaatcttgcatatttttatgcattgtc |
1488387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 205
Target Start/End: Original strand, 3445234 - 3445271
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcata |
205 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
3445234 |
ttggtggtggccgggatttgaaccccggaccttgcata |
3445271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 24636637 - 24636686
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||| ||| | |||||| | |||||||||||||||||||||||||| |
|
|
| T |
24636637 |
gtggtggctggggtttgaacctcggaccttgcatatttttatgcattgtc |
24636686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 4009941 - 4009889
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||||||| | |||||||||| || |||||||||| |
|
|
| T |
4009941 |
ttggtggtggccggggtttgaaccccggcccttgcatatattaatgcattgtc |
4009889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 22522788 - 22522839
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||||| | |||||||||||| |
|
|
| T |
22522788 |
ttggtggtggccggggtttgaaccccggaccttgcata-tattatgcattgtc |
22522839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 34191507 - 34191456
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||| ||||||||| | |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
34191507 |
ttggtagtggccggggtttgaaccccggaccttgcata-ttttatgcattgtc |
34191456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 220
Target Start/End: Complemental strand, 39529517 - 39529470
Alignment:
| Q |
172 |
tggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||||| | |||||||| |||||||||||||||||||||||||| |
|
|
| T |
39529517 |
tggtggccggagtttgaacccc-gaccttgcatatttttatgcattgtc |
39529470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0458 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0458
Description:
Target: scaffold0458; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 11141 - 11190
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||||||||||||| |
|
|
| T |
11141 |
gtggtggccggggtttgaatcccagaccttgcatatttttatgcattgtc |
11190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 10)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 219
Target Start/End: Complemental strand, 39452532 - 39452484
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgt |
219 |
Q |
| |
|
|||||||||||| | |||| ||||||||||||||||||||||||||||| |
|
|
| T |
39452532 |
gtggtggccggggtttgaatcccagaccttgcatatttttatgcattgt |
39452484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 170 - 220
Target Start/End: Original strand, 24752636 - 24752686
Alignment:
| Q |
170 |
ggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| |||||||||||| |
|
|
| T |
24752636 |
ggtggtggccggggttcgaaccccagaccttgcatattattatgcattgtc |
24752686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 8551413 - 8551466
Alignment:
| Q |
168 |
ttggtggtggccggg-atctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||| ||||||||| || |||||||| |||||||||||| ||||||||||||| |
|
|
| T |
8551413 |
ttggtagtggccggggatttgaaccccggaccttgcatatctttatgcattgtc |
8551466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 8736506 - 8736458
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
8736506 |
gtggtggccggggtttgaaccccggaccttgcata-ttttatgcattgtc |
8736458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 48646715 - 48646764
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||||| |||||||||||| |
|
|
| T |
48646715 |
gtggtggccggagtttgaaccccggaccttgcatattattatgcattgtc |
48646764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 52494128 - 52494079
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||| ||| | |||||| | |||||||||||||||||||||||||| |
|
|
| T |
52494128 |
gtggtggctggggtttgaacctcggaccttgcatatttttatgcattgtc |
52494079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 206
Target Start/End: Complemental strand, 3481633 - 3481597
Alignment:
| Q |
170 |
ggtggtggccgggatctgaaccccagaccttgcatat |
206 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
3481633 |
ggtggtggccggggtttgaaccccagaccttgcatat |
3481597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 30382570 - 30382519
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||| | | ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
30382570 |
ttggtggtggccgaggtttgaacgccagaccttgcata-ttttatgcattgtc |
30382519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 42045359 - 42045410
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | ||||| |||||||||||||| | |||||||||||| |
|
|
| T |
42045359 |
ttggtggtggccggggtttgaactccagaccttgcata-tattatgcattgtc |
42045410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 44860870 - 44860921
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
44860870 |
ttggtagtggccggggtttgaaccccagaccttggata-ttttatgcattgtc |
44860921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 7051 - 7002
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||| |||||||||||| |
|
|
| T |
7051 |
gtggtggccgggattcgaaccccagaccttacatattattatgcattgtc |
7002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 209
Target Start/End: Original strand, 27907938 - 27907979
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttt |
209 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
27907938 |
ttggtggtggccggggtttgaaccccagaccttgcatatttt |
27907979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 205
Target Start/End: Complemental strand, 4257675 - 4257638
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcata |
205 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
4257675 |
ttggtggtggccggggtttgaaccccagaccttgcata |
4257638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 12582219 - 12582267
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||||||| | ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
12582219 |
gtggtggccggggtttgaactccagaccttgcata-ttttatgcattgtc |
12582267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 14049871 - 14049923
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtct |
221 |
Q |
| |
|
|||||||||||||| || |||||| ||||||||||||| | ||||||||||||| |
|
|
| T |
14049871 |
ttggtggtggccggaatttgaacctcagaccttgcata-tattatgcattgtct |
14049923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 17935800 - 17935752
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||| |||||| ||||||| |||||||||||| |||||||||||||| |
|
|
| T |
17935800 |
gtggtggtcgggatttgaaccctagaccttgcata-ttttatgcattgtc |
17935752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 11)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 32843252 - 32843300
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
32843252 |
gtggtggccggggtttgaaccccagaccttgcata-ttttatgcattgtc |
32843300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 25340911 - 25340962
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
25340911 |
ttggtggtggccggggtttgaaccccggaccttgcata-ttttatgcattgtc |
25340962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 208
Target Start/End: Complemental strand, 53365978 - 53365938
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatattt |
208 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
53365978 |
ttggtggtggccgggatttgaaccccggaccttgcatattt |
53365938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 206
Target Start/End: Original strand, 55066587 - 55066625
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatat |
206 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
55066587 |
ttggtggtggccgggatttgaaccccagaccatgcatat |
55066625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 25441490 - 25441538
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||| | |||||||||||| |
|
|
| T |
25441490 |
gtggtggccggggtttgaaccccagaccttgcata-tattatgcattgtc |
25441538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 32909291 - 32909339
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
32909291 |
gtggtggccgggatttgaacccaggaccttgcata-ttttatgcattgtc |
32909339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 170 - 219
Target Start/End: Complemental strand, 52576019 - 52575971
Alignment:
| Q |
170 |
ggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgt |
219 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
52576019 |
ggtggtggtcgggattcgaaccccagaccttgcata-ttttatgcattgt |
52575971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 53996370 - 53996322
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| | |||||||||||| |
|
|
| T |
53996370 |
gtggtggccgggattcgaaccccagaccttgcata-tattatgcattgtc |
53996322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 4601918 - 4601867
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||||||| |||||||||| || |||||||||||| |
|
|
| T |
4601918 |
ttggtggtggccggggtttgaaccccggaccttgcat-ttattatgcattgtc |
4601867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 19126664 - 19126715
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||||||| |||| ||||||||| ||||| |||| |||||||||||||| |
|
|
| T |
19126664 |
ttggtggtggccaggatttgaaccccaaaccttacata-ttttatgcattgtc |
19126715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 38130946 - 38130997
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||||| | |||||||||||| |
|
|
| T |
38130946 |
ttggtggtggccggggtttgaaccccggaccttgcata-tattatgcattgtc |
38130997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 55619 - 55567
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
55619 |
ttggtggtggccggggtttgaaacccaaaccttgcatatatttatgcattgtc |
55567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 22975877 - 22975825
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||| ||| | | ||||||||||||||||||| ||||||||||||| |
|
|
| T |
22975877 |
ttggtggtggctggggtttaaaccccagaccttgcatatatttatgcattgtc |
22975825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 24838157 - 24838208
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
24838157 |
ttggtggtggccggggtttgaaccccggaccttgcata-ttttatgcattgtc |
24838208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 220
Target Start/End: Original strand, 35843118 - 35843166
Alignment:
| Q |
172 |
tggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||| | |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
35843118 |
tggtggccggggtttgaaccccggaccttacatatttttatgcattgtc |
35843166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 12748975 - 12748924
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||||| | |||||||||||| |
|
|
| T |
12748975 |
ttggtggtggccggggtttgaaccccggaccttgcata-tattatgcattgtc |
12748924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 32051519 - 32051570
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||||| | |||||||||||| |
|
|
| T |
32051519 |
ttggtggtggccggggtttgaaccccggaccttgcata-tattatgcattgtc |
32051570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 19416588 - 19416537
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
19416588 |
ttggtggtggccggggtttgaaccccggaccttgcata-ttttatgcattgtc |
19416537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 206
Target Start/End: Original strand, 12823255 - 12823290
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatat |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12823255 |
gtggtggccgggatttgaaccccagaccttgcatat |
12823290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 8261430 - 8261482
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtct |
221 |
Q |
| |
|
||||||||||||||||| |||||||| ||||| |||| ||||||||||||||| |
|
|
| T |
8261430 |
ttggtggtggccgggattcgaaccccaaaccttacata-ttttatgcattgtct |
8261482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 8290459 - 8290508
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||| |||||| ||||||| ||||||||||||| |||||||||||| |
|
|
| T |
8290459 |
gtggtggtcgggattcgaaccccggaccttgcatattattatgcattgtc |
8290508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 205
Target Start/End: Original strand, 31038509 - 31038546
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcata |
205 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
31038509 |
ttggtggtggccggggtttgaaccccagaccttgcata |
31038546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 8084501 - 8084450
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
8084501 |
ttggtggtggccggggttcgaaccccggaccttgcata-ttttatgcattgtc |
8084450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 10026068 - 10026017
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||||| |||| | ||||||||| |||||||||| |||||||||||||| |
|
|
| T |
10026068 |
ttggtggtggtcggggtttgaaccccataccttgcata-ttttatgcattgtc |
10026017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 220
Target Start/End: Original strand, 19036093 - 19036140
Alignment:
| Q |
172 |
tggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||| | ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
19036093 |
tggtggccggggtttgaactccagaccttgcata-ttttatgcattgtc |
19036140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 220
Target Start/End: Complemental strand, 20718543 - 20718496
Alignment:
| Q |
172 |
tggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||| | ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
20718543 |
tggtggccggggtttgaactccagaccttgcata-ttttatgcattgtc |
20718496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 56497595 - 56497646
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| | |||||||||||| |
|
|
| T |
56497595 |
ttggtggtggccgggattcgaaccccagaccttgcata-tattatgcattgtc |
56497646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 219
Target Start/End: Original strand, 54857602 - 54857652
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgt |
219 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||||| ||||||||||||| |
|
|
| T |
54857602 |
ttggtggtggccggggtttgaaccccggaccttgcata-ttttatgcattgt |
54857652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 220
Target Start/End: Original strand, 48226495 - 48226536
Alignment:
| Q |
178 |
ccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
48226495 |
ccgggatttgaaccccagaccttgcata-ttttatgcattgtc |
48226536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 16431687 - 16431639
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||| ||||||| | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
16431687 |
gtggaggccggggtttgaaccccagaccttgcata-ttttatgcattgtc |
16431639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 9946501 - 9946450
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||||| |||| | |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
9946501 |
ttggtggtggtcggggtttgaaccccggaccttgcata-ttttatgcattgtc |
9946450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 43034329 - 43034380
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||||| ||||||||||||| | |||||||||||| |
|
|
| T |
43034329 |
ttggtggtggccggggtttgaacctcagaccttgcata-tattatgcattgtc |
43034380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 24592833 - 24592884
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| | |||||||||||| |
|
|
| T |
24592833 |
ttggtggtggccggggtttgaaccccagaccttgcata-tattatgcattgtc |
24592884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 36474836 - 36474785
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
|||||||||||||| || |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
36474836 |
ttggtggtggccggaatttgaaccccggaccttgcata-ttttatgcattgtc |
36474785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 220
Target Start/End: Complemental strand, 41859922 - 41859875
Alignment:
| Q |
172 |
tggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||| | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
41859922 |
tggtggccggggtttgaaccccagaccttgcata-ttttatgcattgtc |
41859875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 216
Target Start/End: Original strand, 19595468 - 19595513
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcat |
216 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||| |||||||| |
|
|
| T |
19595468 |
gtggtggccggggttcgaaccccagaccttgcatattattatgcat |
19595513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 7052848 - 7052796
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||| ||||| | ||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
7052848 |
ttggtggtgtccggggtttgagccccggaccttgcatattattatgcattgtc |
7052796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 29544701 - 29544650
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||||| | |||||||||||| |
|
|
| T |
29544701 |
ttggtggtggccggggtttgaaccccggaccttgcata-tattatgcattgtc |
29544650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 209
Target Start/End: Complemental strand, 9474 - 9436
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttt |
209 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
9474 |
gtggtggccgggatttgaatcccagaccttgcatatttt |
9436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 53370 - 53418
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||| |||| | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
53370 |
gtggtggtcggggtttgaaccccagaccttgcata-ttttatgcattgtc |
53418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 244551 - 244502
Alignment:
| Q |
171 |
gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||| |||||| | ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
244551 |
gtggtggtcgggattttaaccccaaaccttacatatttttatgcattgtc |
244502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0743 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0743
Description:
Target: scaffold0743; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 1406 - 1457
Alignment:
| Q |
168 |
ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc |
220 |
Q |
| |
|
||||||||||| ||| || ||||||||||| ||||||||| |||||||||||| |
|
|
| T |
1406 |
ttggtggtggcggggttc-gaaccccagacgttgcatattattatgcattgtc |
1457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University