View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13460_high_12 (Length: 234)

Name: NF13460_high_12
Description: NF13460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13460_high_12
NF13460_high_12
[»] chr5 (10 HSPs)
chr5 (1-156)||(1488455-1488603)
chr5 (168-220)||(32559327-32559378)
chr5 (168-220)||(6489030-6489081)
chr5 (174-220)||(1488387-1488433)
chr5 (168-205)||(3445234-3445271)
chr5 (171-220)||(24636637-24636686)
chr5 (168-220)||(4009889-4009941)
chr5 (168-220)||(22522788-22522839)
chr5 (168-220)||(34191456-34191507)
chr5 (172-220)||(39529470-39529517)
[»] scaffold0458 (1 HSPs)
scaffold0458 (171-220)||(11141-11190)
[»] chr1 (10 HSPs)
chr1 (171-219)||(39452484-39452532)
chr1 (170-220)||(24752636-24752686)
chr1 (168-220)||(8551413-8551466)
chr1 (171-220)||(8736458-8736506)
chr1 (171-220)||(48646715-48646764)
chr1 (171-220)||(52494079-52494128)
chr1 (170-206)||(3481597-3481633)
chr1 (168-220)||(30382519-30382570)
chr1 (168-220)||(42045359-42045410)
chr1 (168-220)||(44860870-44860921)
[»] scaffold0328 (1 HSPs)
scaffold0328 (171-220)||(7002-7051)
[»] chr6 (5 HSPs)
chr6 (168-209)||(27907938-27907979)
chr6 (168-205)||(4257638-4257675)
chr6 (171-220)||(12582219-12582267)
chr6 (168-221)||(14049871-14049923)
chr6 (171-220)||(17935752-17935800)
[»] chr3 (11 HSPs)
chr3 (171-220)||(32843252-32843300)
chr3 (168-220)||(25340911-25340962)
chr3 (168-208)||(53365938-53365978)
chr3 (168-206)||(55066587-55066625)
chr3 (171-220)||(25441490-25441538)
chr3 (171-220)||(32909291-32909339)
chr3 (170-219)||(52575971-52576019)
chr3 (171-220)||(53996322-53996370)
chr3 (168-220)||(4601867-4601918)
chr3 (168-220)||(19126664-19126715)
chr3 (168-220)||(38130946-38130997)
[»] scaffold0063 (1 HSPs)
scaffold0063 (168-220)||(55567-55619)
[»] chr8 (5 HSPs)
chr8 (168-220)||(22975825-22975877)
chr8 (168-220)||(24838157-24838208)
chr8 (172-220)||(35843118-35843166)
chr8 (168-220)||(12748924-12748975)
chr8 (168-220)||(32051519-32051570)
[»] chr7 (9 HSPs)
chr7 (168-220)||(19416537-19416588)
chr7 (171-206)||(12823255-12823290)
chr7 (168-221)||(8261430-8261482)
chr7 (171-220)||(8290459-8290508)
chr7 (168-205)||(31038509-31038546)
chr7 (168-220)||(8084450-8084501)
chr7 (168-220)||(10026017-10026068)
chr7 (172-220)||(19036093-19036140)
chr7 (172-220)||(20718496-20718543)
[»] chr4 (6 HSPs)
chr4 (168-220)||(56497595-56497646)
chr4 (168-219)||(54857602-54857652)
chr4 (178-220)||(48226495-48226536)
chr4 (171-220)||(16431639-16431687)
chr4 (168-220)||(9946450-9946501)
chr4 (168-220)||(43034329-43034380)
[»] chr2 (6 HSPs)
chr2 (168-220)||(24592833-24592884)
chr2 (168-220)||(36474785-36474836)
chr2 (172-220)||(41859875-41859922)
chr2 (171-216)||(19595468-19595513)
chr2 (168-220)||(7052796-7052848)
chr2 (168-220)||(29544650-29544701)
[»] scaffold0168 (1 HSPs)
scaffold0168 (171-209)||(9436-9474)
[»] scaffold0050 (1 HSPs)
scaffold0050 (171-220)||(53370-53418)
[»] scaffold0007 (1 HSPs)
scaffold0007 (171-220)||(244502-244551)
[»] scaffold0743 (1 HSPs)
scaffold0743 (168-220)||(1406-1457)


Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 10)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 1488603 - 1488455
Alignment:
1 gctaaaatataagacacaagttcacaataacaacgccattgcccattgatagctaatagtggcaataaaagtatttgttttatcgtatccacagagactt 100  Q
    ||||||||||||||||||||||| ||| |||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||    
1488603 gctaaaatataagacacaagttcccaacaacaacgccattg-------atagctaatagtggcaataaaagtatttgttttatcgtatccacagagactt 1488511  T
101 gcggtacatttttgccgttcagctatttatattatcttaagtagggttgaataagg 156  Q
    ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||    
1488510 gcggtacatttttgctgttcagctacttatattatcttaagtagggttgaataagg 1488455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 32559378 - 32559327
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||||| ||||||||||||||| |||| ||||||||||||||    
32559378 ttggtggtggccgggatttgaaccccagaccttacata-ttttatgcattgtc 32559327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 6489081 - 6489030
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||||||||||||||||||| | ||||||||||||    
6489081 ttggtggtggccggggtttgaaccccagaccttgcata-tattatgcattgtc 6489030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 220
Target Start/End: Complemental strand, 1488433 - 1488387
Alignment:
174 gtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||| ||||||||  | |||||||||||||||||||||||    
1488433 gtggccgggatttgaaccccgaatcttgcatatttttatgcattgtc 1488387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 205
Target Start/End: Original strand, 3445234 - 3445271
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcata 205  Q
    ||||||||||||||||| |||||||| |||||||||||    
3445234 ttggtggtggccgggatttgaaccccggaccttgcata 3445271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 24636637 - 24636686
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||| ||| | |||||| | ||||||||||||||||||||||||||    
24636637 gtggtggctggggtttgaacctcggaccttgcatatttttatgcattgtc 24636686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 4009941 - 4009889
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||||||| | |||||||||| || ||||||||||    
4009941 ttggtggtggccggggtttgaaccccggcccttgcatatattaatgcattgtc 4009889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 22522788 - 22522839
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||||||| ||||||||||| | ||||||||||||    
22522788 ttggtggtggccggggtttgaaccccggaccttgcata-tattatgcattgtc 22522839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 34191507 - 34191456
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||| ||||||||| | |||||||| ||||||||||| ||||||||||||||    
34191507 ttggtagtggccggggtttgaaccccggaccttgcata-ttttatgcattgtc 34191456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 220
Target Start/End: Complemental strand, 39529517 - 39529470
Alignment:
172 tggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||  | |||||||| ||||||||||||||||||||||||||    
39529517 tggtggccggagtttgaacccc-gaccttgcatatttttatgcattgtc 39529470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0458 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0458
Description:

Target: scaffold0458; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 11141 - 11190
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||||||| | |||| ||||||||||||||||||||||||||||||    
11141 gtggtggccggggtttgaatcccagaccttgcatatttttatgcattgtc 11190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 10)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 219
Target Start/End: Complemental strand, 39452532 - 39452484
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgt 219  Q
    |||||||||||| | |||| |||||||||||||||||||||||||||||    
39452532 gtggtggccggggtttgaatcccagaccttgcatatttttatgcattgt 39452484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 170 - 220
Target Start/End: Original strand, 24752636 - 24752686
Alignment:
170 ggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||| |  ||||||||||||||||||||| ||||||||||||    
24752636 ggtggtggccggggttcgaaccccagaccttgcatattattatgcattgtc 24752686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 8551413 - 8551466
Alignment:
168 ttggtggtggccggg-atctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||| ||||||||| || |||||||| |||||||||||| |||||||||||||    
8551413 ttggtagtggccggggatttgaaccccggaccttgcatatctttatgcattgtc 8551466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 8736506 - 8736458
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||||||| | |||||||| ||||||||||| ||||||||||||||    
8736506 gtggtggccggggtttgaaccccggaccttgcata-ttttatgcattgtc 8736458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 48646715 - 48646764
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||||||  | |||||||| ||||||||||||| ||||||||||||    
48646715 gtggtggccggagtttgaaccccggaccttgcatattattatgcattgtc 48646764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 52494128 - 52494079
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||| ||| | |||||| | ||||||||||||||||||||||||||    
52494128 gtggtggctggggtttgaacctcggaccttgcatatttttatgcattgtc 52494079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 206
Target Start/End: Complemental strand, 3481633 - 3481597
Alignment:
170 ggtggtggccgggatctgaaccccagaccttgcatat 206  Q
    ||||||||||||| | |||||||||||||||||||||    
3481633 ggtggtggccggggtttgaaccccagaccttgcatat 3481597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 30382570 - 30382519
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||| | | ||||| |||||||||||||| ||||||||||||||    
30382570 ttggtggtggccgaggtttgaacgccagaccttgcata-ttttatgcattgtc 30382519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 42045359 - 42045410
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | ||||| |||||||||||||| | ||||||||||||    
42045359 ttggtggtggccggggtttgaactccagaccttgcata-tattatgcattgtc 42045410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 44860870 - 44860921
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||| ||||||||| | |||||||||||||||| ||| ||||||||||||||    
44860870 ttggtagtggccggggtttgaaccccagaccttggata-ttttatgcattgtc 44860921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0328 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0328
Description:

Target: scaffold0328; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 7051 - 7002
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||  |||||||||||||| |||||| ||||||||||||    
7051 gtggtggccgggattcgaaccccagaccttacatattattatgcattgtc 7002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 209
Target Start/End: Original strand, 27907938 - 27907979
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttt 209  Q
    ||||||||||||||| | ||||||||||||||||||||||||    
27907938 ttggtggtggccggggtttgaaccccagaccttgcatatttt 27907979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 205
Target Start/End: Complemental strand, 4257675 - 4257638
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcata 205  Q
    ||||||||||||||| | ||||||||||||||||||||    
4257675 ttggtggtggccggggtttgaaccccagaccttgcata 4257638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 12582219 - 12582267
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||||||| | ||||| |||||||||||||| ||||||||||||||    
12582219 gtggtggccggggtttgaactccagaccttgcata-ttttatgcattgtc 12582267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 14049871 - 14049923
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtct 221  Q
    |||||||||||||| || |||||| ||||||||||||| | |||||||||||||    
14049871 ttggtggtggccggaatttgaacctcagaccttgcata-tattatgcattgtct 14049923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 17935800 - 17935752
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||| |||||| ||||||| |||||||||||| ||||||||||||||    
17935800 gtggtggtcgggatttgaaccctagaccttgcata-ttttatgcattgtc 17935752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 11)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 32843252 - 32843300
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||||||| | |||||||||||||||||||| ||||||||||||||    
32843252 gtggtggccggggtttgaaccccagaccttgcata-ttttatgcattgtc 32843300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 25340911 - 25340962
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||||||| ||||||||||| ||||||||||||||    
25340911 ttggtggtggccggggtttgaaccccggaccttgcata-ttttatgcattgtc 25340962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 208
Target Start/End: Complemental strand, 53365978 - 53365938
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatattt 208  Q
    ||||||||||||||||| |||||||| ||||||||||||||    
53365978 ttggtggtggccgggatttgaaccccggaccttgcatattt 53365938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 206
Target Start/End: Original strand, 55066587 - 55066625
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatat 206  Q
    ||||||||||||||||| ||||||||||||| |||||||    
55066587 ttggtggtggccgggatttgaaccccagaccatgcatat 55066625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 25441490 - 25441538
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||||||| | |||||||||||||||||||| | ||||||||||||    
25441490 gtggtggccggggtttgaaccccagaccttgcata-tattatgcattgtc 25441538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 32909291 - 32909339
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||||||||| |||||||  ||||||||||| ||||||||||||||    
32909291 gtggtggccgggatttgaacccaggaccttgcata-ttttatgcattgtc 32909339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 170 - 219
Target Start/End: Complemental strand, 52576019 - 52575971
Alignment:
170 ggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgt 219  Q
    |||||||| ||||||  ||||||||||||||||||| |||||||||||||    
52576019 ggtggtggtcgggattcgaaccccagaccttgcata-ttttatgcattgt 52575971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 53996370 - 53996322
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||  ||||||||||||||||||| | ||||||||||||    
53996370 gtggtggccgggattcgaaccccagaccttgcata-tattatgcattgtc 53996322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 4601918 - 4601867
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||||||| |||||||||| || ||||||||||||    
4601918 ttggtggtggccggggtttgaaccccggaccttgcat-ttattatgcattgtc 4601867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 19126664 - 19126715
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||||||| |||| ||||||||| ||||| |||| ||||||||||||||    
19126664 ttggtggtggccaggatttgaaccccaaaccttacata-ttttatgcattgtc 19126715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 38130946 - 38130997
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||||||| ||||||||||| | ||||||||||||    
38130946 ttggtggtggccggggtttgaaccccggaccttgcata-tattatgcattgtc 38130997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0063 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0063
Description:

Target: scaffold0063; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 55619 - 55567
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||| |||| ||||||||||| |||||||||||||    
55619 ttggtggtggccggggtttgaaacccaaaccttgcatatatttatgcattgtc 55567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 22975877 - 22975825
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||| ||| | | ||||||||||||||||||| |||||||||||||    
22975877 ttggtggtggctggggtttaaaccccagaccttgcatatatttatgcattgtc 22975825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 24838157 - 24838208
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||||||| ||||||||||| ||||||||||||||    
24838157 ttggtggtggccggggtttgaaccccggaccttgcata-ttttatgcattgtc 24838208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 220
Target Start/End: Original strand, 35843118 - 35843166
Alignment:
172 tggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||| | |||||||| |||||| |||||||||||||||||||    
35843118 tggtggccggggtttgaaccccggaccttacatatttttatgcattgtc 35843166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 12748975 - 12748924
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||||||| ||||||||||| | ||||||||||||    
12748975 ttggtggtggccggggtttgaaccccggaccttgcata-tattatgcattgtc 12748924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 32051519 - 32051570
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||||||| ||||||||||| | ||||||||||||    
32051519 ttggtggtggccggggtttgaaccccggaccttgcata-tattatgcattgtc 32051570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 9)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 19416588 - 19416537
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||||||| ||||||||||| ||||||||||||||    
19416588 ttggtggtggccggggtttgaaccccggaccttgcata-ttttatgcattgtc 19416537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 206
Target Start/End: Original strand, 12823255 - 12823290
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatat 206  Q
    |||||||||||||| |||||||||||||||||||||    
12823255 gtggtggccgggatttgaaccccagaccttgcatat 12823290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 8261430 - 8261482
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtct 221  Q
    |||||||||||||||||  |||||||| ||||| |||| |||||||||||||||    
8261430 ttggtggtggccgggattcgaaccccaaaccttacata-ttttatgcattgtct 8261482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 8290459 - 8290508
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||| ||||||  ||||||| ||||||||||||| ||||||||||||    
8290459 gtggtggtcgggattcgaaccccggaccttgcatattattatgcattgtc 8290508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 168 - 205
Target Start/End: Original strand, 31038509 - 31038546
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcata 205  Q
    ||||||||||||||| | ||||||||||||||||||||    
31038509 ttggtggtggccggggtttgaaccccagaccttgcata 31038546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 8084501 - 8084450
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| |  ||||||| ||||||||||| ||||||||||||||    
8084501 ttggtggtggccggggttcgaaccccggaccttgcata-ttttatgcattgtc 8084450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 10026068 - 10026017
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||||| |||| | ||||||||| |||||||||| ||||||||||||||    
10026068 ttggtggtggtcggggtttgaaccccataccttgcata-ttttatgcattgtc 10026017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 220
Target Start/End: Original strand, 19036093 - 19036140
Alignment:
172 tggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||| | ||||| |||||||||||||| ||||||||||||||    
19036093 tggtggccggggtttgaactccagaccttgcata-ttttatgcattgtc 19036140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 220
Target Start/End: Complemental strand, 20718543 - 20718496
Alignment:
172 tggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||| | ||||| |||||||||||||| ||||||||||||||    
20718543 tggtggccggggtttgaactccagaccttgcata-ttttatgcattgtc 20718496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 56497595 - 56497646
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||||||||||||  ||||||||||||||||||| | ||||||||||||    
56497595 ttggtggtggccgggattcgaaccccagaccttgcata-tattatgcattgtc 56497646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 219
Target Start/End: Original strand, 54857602 - 54857652
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgt 219  Q
    ||||||||||||||| | |||||||| ||||||||||| |||||||||||||    
54857602 ttggtggtggccggggtttgaaccccggaccttgcata-ttttatgcattgt 54857652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 220
Target Start/End: Original strand, 48226495 - 48226536
Alignment:
178 ccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||| |||||||||||||||||||| ||||||||||||||    
48226495 ccgggatttgaaccccagaccttgcata-ttttatgcattgtc 48226536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 16431687 - 16431639
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||| ||||||| | |||||||||||||||||||| ||||||||||||||    
16431687 gtggaggccggggtttgaaccccagaccttgcata-ttttatgcattgtc 16431639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 9946501 - 9946450
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||||| |||| | |||||||| ||||||||||| ||||||||||||||    
9946501 ttggtggtggtcggggtttgaaccccggaccttgcata-ttttatgcattgtc 9946450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 43034329 - 43034380
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||||| ||||||||||||| | ||||||||||||    
43034329 ttggtggtggccggggtttgaacctcagaccttgcata-tattatgcattgtc 43034380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 24592833 - 24592884
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||||||||||||||||||| | ||||||||||||    
24592833 ttggtggtggccggggtttgaaccccagaccttgcata-tattatgcattgtc 24592884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 36474836 - 36474785
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    |||||||||||||| || |||||||| ||||||||||| ||||||||||||||    
36474836 ttggtggtggccggaatttgaaccccggaccttgcata-ttttatgcattgtc 36474785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 220
Target Start/End: Complemental strand, 41859922 - 41859875
Alignment:
172 tggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||| | |||||||||||||||||||| ||||||||||||||    
41859922 tggtggccggggtttgaaccccagaccttgcata-ttttatgcattgtc 41859875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 216
Target Start/End: Original strand, 19595468 - 19595513
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcat 216  Q
    |||||||||||| |  ||||||||||||||||||||| ||||||||    
19595468 gtggtggccggggttcgaaccccagaccttgcatattattatgcat 19595513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 7052848 - 7052796
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||| ||||| | ||| |||| ||||||||||||| ||||||||||||    
7052848 ttggtggtgtccggggtttgagccccggaccttgcatattattatgcattgtc 7052796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 29544701 - 29544650
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||||||| | |||||||| ||||||||||| | ||||||||||||    
29544701 ttggtggtggccggggtttgaaccccggaccttgcata-tattatgcattgtc 29544650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 209
Target Start/End: Complemental strand, 9474 - 9436
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttt 209  Q
    |||||||||||||| |||| |||||||||||||||||||    
9474 gtggtggccgggatttgaatcccagaccttgcatatttt 9436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Original strand, 53370 - 53418
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||| |||| | |||||||||||||||||||| ||||||||||||||    
53370 gtggtggtcggggtttgaaccccagaccttgcata-ttttatgcattgtc 53418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 244551 - 244502
Alignment:
171 gtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||| |||||| | ||||||| ||||| |||||||||||||||||||    
244551 gtggtggtcgggattttaaccccaaaccttacatatttttatgcattgtc 244502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0743 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0743
Description:

Target: scaffold0743; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 1406 - 1457
Alignment:
168 ttggtggtggccgggatctgaaccccagaccttgcatatttttatgcattgtc 220  Q
    ||||||||||| ||| || ||||||||||| ||||||||| ||||||||||||    
1406 ttggtggtggcggggttc-gaaccccagacgttgcatattattatgcattgtc 1457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University