View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13461_low_5 (Length: 240)
Name: NF13461_low_5
Description: NF13461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13461_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 3 - 225
Target Start/End: Complemental strand, 12731535 - 12731313
Alignment:
| Q |
3 |
caaccaccaccggaaccctctcataaaacccacttcccacaccttcgaactcatccaacttaaccacagcgtcatccgaaaccgcgtaaacttctccctt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12731535 |
caaccaccaccggaaccctctcataaaacccacttcccacaccttcgaactcatccaacttaaccacagcgtcatccgaaaccgcgtaaacttctccctt |
12731436 |
T |
 |
| Q |
103 |
caccttatgacccgacccgggtaggttgatcaggtacggtattccgtggggtccaatcaccagtggatacggtttctgtgtggagtatgtattcatgaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12731435 |
caccttatgacccgacccgggtaggttgatcaggtacggtattccgtggggtccaatcaccagtggatacggtttctgtgtggagtatgtattcatgaaa |
12731336 |
T |
 |
| Q |
203 |
acggcgtcgtctttggttttaag |
225 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12731335 |
acggcgtcgtctttggttttaag |
12731313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 3 - 225
Target Start/End: Complemental strand, 12794325 - 12794103
Alignment:
| Q |
3 |
caaccaccaccggaaccctctcataaaacccacttcccacaccttcgaactcatccaacttaaccacagcgtcatccgaaaccgcgtaaacttctccctt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12794325 |
caaccaccaccggaaccctctcataaaacccacttcccacaccttcgaactcatccaacttaaccacagcgtcatccgaaaccgcgtaaacttctccctt |
12794226 |
T |
 |
| Q |
103 |
caccttatgacccgacccgggtaggttgatcaggtacggtattccgtggggtccaatcaccagtggatacggtttctgtgtggagtatgtattcatgaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12794225 |
caccttatgacccgacccgggtaggttgatcaggtacggtattccgtggggtccaatcaccagtggatacggtttctgtgtggagtatgtattcatgaaa |
12794126 |
T |
 |
| Q |
203 |
acggcgtcgtctttggttttaag |
225 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12794125 |
acggcgtcgtctttggttttaag |
12794103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University