View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13462_high_11 (Length: 227)
Name: NF13462_high_11
Description: NF13462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13462_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 48206555 - 48206774
Alignment:
| Q |
1 |
tcatcaatttttcaactactactttgtattttttatctnnnnnnnnt-----tgaatgggaaactttggatttggattgactgcacttgagttccttgca |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48206555 |
tcatcaatttttcaactactactttgtattttttatctaaaaaaaatataattgaatgggaaactttggatttggatttactgcacttgagttccttgca |
48206654 |
T |
 |
| Q |
96 |
gttaggtgcaatcatgtatattttgtgacagaggagtgtcttttgggcaagagagaatacatatttcaaacaaaaataatatactcagggaaaactttgt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48206655 |
gttaggtgcaatcatgtatattttgtgagagaggagtgtcttttgggcaagagagaatacatatttcaaacaaaaataatatactcaggggaaactttgt |
48206754 |
T |
 |
| Q |
196 |
gtgtagacttcagaaactgc |
215 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
48206755 |
gtgtagacttcagaaactgc |
48206774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University