View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13462_low_14 (Length: 236)
Name: NF13462_low_14
Description: NF13462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13462_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 31 - 171
Target Start/End: Original strand, 35441543 - 35441683
Alignment:
| Q |
31 |
cattattaaaattttgaagtccaagaattcttttcttaaaaatatttgaaattaaactctgtttattttatattccaggaaaaaccttccaatggttgct |
130 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35441543 |
cattattaaaatttagaagtccaagaattcttttcttaaaaatatttgaaattaaaccgtgtttattttatattccaggaaaaaccttccaatggttgct |
35441642 |
T |
 |
| Q |
131 |
cttttcgccctccaccaatgtgcaaaccattccagatgaca |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35441643 |
cttttcgccctccaccaatgtgcaaaccattccagatgaca |
35441683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 222
Target Start/End: Original strand, 35441695 - 35441729
Alignment:
| Q |
188 |
aggtttcggtaagataaataacatccatcaaatct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35441695 |
aggtttcggtaagataaataacatccatcaaatct |
35441729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University