View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13465_high_7 (Length: 243)
Name: NF13465_high_7
Description: NF13465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13465_high_7 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 23 - 243
Target Start/End: Original strand, 13765972 - 13766192
Alignment:
| Q |
23 |
gatgttgcaaagatcaaacaagcgattgtgaatttctttacgcatcatttctcagacccatagacctatagaccgaccatggtcgatattgatttcattc |
122 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
13765972 |
gatgttgcaaagaacaaacaagcgattgtgaatttctttacgcatcatttctcagacccatagacctatagaccgaccatgggcgatattgatttctttc |
13766071 |
T |
|
| Q |
123 |
atatttctaatttggataatgtcctgttgttagctctagtcttggtttcaaaaatggaattggtggtttctagtgtggatggtaacgagatccctatacc |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| || |
|
|
| T |
13766072 |
atatttctaatttggataatgttctgttgtcagctcaattcttggtttcaaaaatggaattggtggtttctagtctggatggtaacgagagccctaggcc |
13766171 |
T |
|
| Q |
223 |
ggacggatttaatctcaactt |
243 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13766172 |
ggacggatttaatctcaactt |
13766192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University