View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13465_low_6 (Length: 251)
Name: NF13465_low_6
Description: NF13465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13465_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 5 - 244
Target Start/End: Original strand, 13766434 - 13766676
Alignment:
| Q |
5 |
aaccaatcggccttcgttagagggagacaacatgtagatggggttgtggctgtaaatgagattattgttttgaggggagatggggtcgtgga-tatagtg |
103 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| || |||| |
|
|
| T |
13766434 |
aaccaatcgaccttcgttagagggagacaacatgtagatggggttgtggctataaatgagattattgttttgatgggagatggggtcgtggactagagtg |
13766533 |
T |
|
| Q |
104 |
tgtgtgtttacaggtagcctgctgtcctggtcaattgttctcctacctaagaaatagacattcaaaaagggctcaagcaaggag--acggtgttttttgt |
201 |
Q |
| |
|
|||||||||| | |||||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13766534 |
tgtgtgtttataagtagcctgctatcctggtcaattgttctcctacctaagaaatcgatattcaaaaagggctcaagcaaggagacacggtgttttttgt |
13766633 |
T |
|
| Q |
202 |
ctgtgaagaagaacttttgactggtatggtggatattcttcga |
244 |
Q |
| |
|
|| ||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13766634 |
ctatgaggaagaacttttgactggtatggtggatatccttcga |
13766676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University