View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13465_low_8 (Length: 243)

Name: NF13465_low_8
Description: NF13465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13465_low_8
NF13465_low_8
[»] chr6 (1 HSPs)
chr6 (23-243)||(13765972-13766192)


Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 23 - 243
Target Start/End: Original strand, 13765972 - 13766192
Alignment:
23 gatgttgcaaagatcaaacaagcgattgtgaatttctttacgcatcatttctcagacccatagacctatagaccgaccatggtcgatattgatttcattc 122  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||    
13765972 gatgttgcaaagaacaaacaagcgattgtgaatttctttacgcatcatttctcagacccatagacctatagaccgaccatgggcgatattgatttctttc 13766071  T
123 atatttctaatttggataatgtcctgttgttagctctagtcttggtttcaaaaatggaattggtggtttctagtgtggatggtaacgagatccctatacc 222  Q
    |||||||||||||||||||||| ||||||| ||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||  ||    
13766072 atatttctaatttggataatgttctgttgtcagctcaattcttggtttcaaaaatggaattggtggtttctagtctggatggtaacgagagccctaggcc 13766171  T
223 ggacggatttaatctcaactt 243  Q
    |||||||||||||||||||||    
13766172 ggacggatttaatctcaactt 13766192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University