View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13465_low_9 (Length: 227)
Name: NF13465_low_9
Description: NF13465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13465_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 7 - 218
Target Start/End: Complemental strand, 45969639 - 45969428
Alignment:
| Q |
7 |
gtttgcacttccaacttttcttgcaagctgtagtcaccagtgagtttcccataagctctaagcagaatgatccaccacaatcctatcaaggaaccaacca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45969639 |
gtttgcacttccaacttttcttgcaagctgtagtcaccagtgagtttcccataagctctaagcagaatgatccaccacaatcctatcaaggaaccaacca |
45969540 |
T |
|
| Q |
107 |
tagnnnnnnnnntcatcttatgaagtcaatgatcaacatagattatggaaatgacttctctgttacataattattattctctctttcctataataaatgt |
206 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
45969539 |
tagaaaaaaaaatcatcttatgaagtcaatgatcaacatagattatggaaatgacttctctgttacataattattactccctctgtcctataataaatgt |
45969440 |
T |
|
| Q |
207 |
cacaattacaac |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45969439 |
cacaattacaac |
45969428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 95
Target Start/End: Original strand, 37653886 - 37653958
Alignment:
| Q |
23 |
tttcttgcaagctgtagtcaccagtgagtttcccataagctctaagcagaatgatccaccacaatcctatcaa |
95 |
Q |
| |
|
|||||||||| ||||||||||| |||| ||||||||||| | | || ||||||||||||||||||||||| |
|
|
| T |
37653886 |
tttcttgcaaactgtagtcaccggtgatcttcccataagcccgtaataggatgatccaccacaatcctatcaa |
37653958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University