View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13466_high_4 (Length: 214)
Name: NF13466_high_4
Description: NF13466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13466_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 25968982 - 25968802
Alignment:
| Q |
15 |
agcaaaggactttgggtatatagagtgtaaggcagctgctaagttctgttcannnnnnnnnnnnnnnnnnnnnnnnnagaatggacattgatttcaaaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25968982 |
agcaaaggactttgggtatatagagtgtaaggcagctgctaagttctgttcatctctttttctctctcgctctctctagaatggacattgatttcaaaga |
25968883 |
T |
|
| Q |
115 |
ataccaattacgctgtgaactccacggccacgaagacgacgttcgcggaataactatctgcggcggcgataacggcggaat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25968882 |
ataccaattacgctgtgaactccacggccacgaagacgacgttcgcggaataactatctgcggcggcgataacggcggaat |
25968802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University