View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13466_low_6 (Length: 201)

Name: NF13466_low_6
Description: NF13466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13466_low_6
NF13466_low_6
[»] chr2 (1 HSPs)
chr2 (17-181)||(6897282-6897446)


Alignment Details
Target: chr2 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 17 - 181
Target Start/End: Complemental strand, 6897446 - 6897282
Alignment:
17 aatatgtaacacaactaaaaattaccatagccatcatgatttttctttaaaatttaaaacaaaaaagagtttgtgcatgtgagtttaaaaatttgcaata 116  Q
    ||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6897446 aatatgtgacacaactaaaaattaccatagccaacatgatttttctttaaaatttaaaacaaaaaagagtttgtgcatgtgagtttaaaaatttgcaata 6897347  T
117 caaaactgtatacaacatcctcattgtacaccagcctaannnnnnnaaacttcaaccatcataat 181  Q
    |||||||||||||||||||||||||||||||||||||||       ||||||||| |||||||||    
6897346 caaaactgtatacaacatcctcattgtacaccagcctaatttttttaaacttcaaacatcataat 6897282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University