View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13467_high_4 (Length: 262)
Name: NF13467_high_4
Description: NF13467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13467_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 25 - 245
Target Start/End: Complemental strand, 41533525 - 41533305
Alignment:
| Q |
25 |
ctaacggttattattatcctttgaatcttctaggtgatgttgctgctgggttaactccggtgagttttcatggtttgttgagtggtgtatcggagaaggg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41533525 |
ctaacggttattattatcctttgaatcttctaggtgatgttgctgctgggttaactccggtgagttttcatggtttgttgagtggtgtatcggagaaggg |
41533426 |
T |
 |
| Q |
125 |
attctctacgttgtggtgcagccaagttccgtgttcccctagtgaagttgaatcgaactcgaaggaggaaatggttgcggtgaagaagaaacgggttcaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41533425 |
attctctacgttgtggtgcagccaagttccgtgttcccctagtgaagttgaatcgaactcgaaggaggaaatggttgcggtgaagaagaaacgggttcaa |
41533326 |
T |
 |
| Q |
225 |
agaccaccattagtgagaact |
245 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41533325 |
agaccaccattagtgagaact |
41533305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University