View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13467_high_5 (Length: 248)
Name: NF13467_high_5
Description: NF13467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13467_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 229
Target Start/End: Complemental strand, 16846371 - 16846156
Alignment:
| Q |
14 |
agatgaacgaccaccaacgataatgattctaccgtttggtagaatctgattcgaagcataccaacgactcgaagaaagattctgttgaagctcttcccaa |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16846371 |
agatgaacgaccaccaacgacaatgattctaccgtttggtagaatctgattcgaagcataccaacgactcgaagaaagattctgttgaagctcttcccaa |
16846272 |
T |
 |
| Q |
114 |
tcacacgtgttgttatgaggacaaggcgtaaacgttctgagtttggtgtaaccatcgttgaagccaccggtttggattagggttccggtgggagagactg |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16846271 |
tcacacgtgttgttatgaggacaaggggtaaacgttctgagtttggtgtaaccatcgttgaagccaccggtttggattagggttccggtgggggagactg |
16846172 |
T |
 |
| Q |
214 |
caccggaggaacacca |
229 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
16846171 |
caccggaggaacacca |
16846156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 229
Target Start/End: Complemental strand, 52913319 - 52913255
Alignment:
| Q |
165 |
ccatcgttgaagccaccggtttggattagggttccggtgggagagactgcaccggaggaacacca |
229 |
Q |
| |
|
||||||||||| |||||||||||||| || |||||| ||||| ||| | ||||||||||||||| |
|
|
| T |
52913319 |
ccatcgttgaaaccaccggtttggataagagttccgttgggattgacggaaccggaggaacacca |
52913255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University