View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13469_high_1 (Length: 881)
Name: NF13469_high_1
Description: NF13469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13469_high_1 |
 | |
|
| [»] scaffold0096 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 7e-76
Query Start/End: Original strand, 357 - 505
Target Start/End: Original strand, 38723251 - 38723399
Alignment:
| Q |
357 |
gtgaaacgtagatcatcgccgttcttaaccgagactcaggttaagctccgtctcggaacctagtggggttaggagtaaagcatcccgaggttggcgcatc |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38723251 |
gtgaaacgtagatcatcgccgttcttaaccgagactcaggttaagctccgtctcggaacctagtggggttaggagtaaagcatcccgaggttggcgcatc |
38723350 |
T |
|
| Q |
457 |
tcgttgggcgtggagaagcattgggaatctccatttctttcttcggagc |
505 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38723351 |
tcgttgtgcgtggagaagcattgggaatctccatttctttcttcggagc |
38723399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096 (Bit Score: 45; Significance: 4e-16; HSPs: 1)
Name: scaffold0096
Description:
Target: scaffold0096; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 604 - 648
Target Start/End: Complemental strand, 41815 - 41771
Alignment:
| Q |
604 |
aggaaccgtctaccagttggcaagctagacatcaagtaagtggct |
648 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41815 |
aggaaccgtctaccagttggcaagctagacatcaagtaagtggct |
41771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 260
Target Start/End: Complemental strand, 38537662 - 38537610
Alignment:
| Q |
208 |
tgtatccgtattgaagagatgcgacaaagtctgcggataattttgcaatgtcc |
260 |
Q |
| |
|
||||||| |||| ||| |||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
38537662 |
tgtatccatatttaagggatgcggcaaagtctgtggataattttgcaatgtcc |
38537610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 453 - 524
Target Start/End: Complemental strand, 25550362 - 25550291
Alignment:
| Q |
453 |
catctcgttgggcgtggagaagcattgggaatctccatttctttcttcggagccgtttcttttcccgtcccc |
524 |
Q |
| |
|
||||| |||||| ||||||||||||| ||||| ||||||||||| || |||||| || |||||||||||| |
|
|
| T |
25550362 |
catcttgttgggtgtggagaagcattaggaatttccatttcttttctcacagccgtatcatttcccgtcccc |
25550291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University