View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13469_high_10 (Length: 406)
Name: NF13469_high_10
Description: NF13469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13469_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 30 - 385
Target Start/End: Original strand, 44005959 - 44006310
Alignment:
| Q |
30 |
cttacatatccattgtctttacttttgttggtattgatctataacgggagaataaaaagtaacatgattatgcaaataattcagatttattttgtttaag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44005959 |
cttacatatccattgtctttacttttgttgatattgatctataacgggagaataaaaagtaacatgattatgcaaataattcagatttattttgtttaag |
44006058 |
T |
|
| Q |
130 |
caactgccatgtctatagtaattattactgtgttagctcagctgctgctgttatttttcttgttgtttctctcttttgtattcccttttgcgtgctcttg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44006059 |
caactgccatgtctatagtaattattactgtgttagctcagctgctgctgttatttttc---ttgtttctctcttttgtattcccttttgcgtgctcttg |
44006155 |
T |
|
| Q |
230 |
ctcatcttgtgctcaaagcttcctgtgattaataaattttgctaattcnnnnnnnnnnnnntgtctatagtaatcggatgtttttctttgnnnnnnncta |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
44006156 |
ctcatcttgtgctcaaagcttcctgtgattaataaattttgctaattc-aaaaaaaaaatatgtctatagtaatcggatgtttttctttgaaaaaaacta |
44006254 |
T |
|
| Q |
330 |
caaccaaatgttattatgaaagtgatcaattgtcctgtctaaagtaacatgatgat |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44006255 |
caaccaaatgttattatgaaagtgatcaattgtcctgtctaaagtaacatgatgat |
44006310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University