View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13469_high_22 (Length: 332)
Name: NF13469_high_22
Description: NF13469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13469_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 4e-97; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 11 - 231
Target Start/End: Complemental strand, 50573472 - 50573252
Alignment:
| Q |
11 |
cataggaacacgcaagaccatccaaccatctgcggaagttgacattcatatggcttcgaatcttgaaatcctaaagcataaataaaggctaaggaatcaa |
110 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50573472 |
cataggaacgcgcaagaccatccaaccatttgcggaagttgacattcatctggctgcgaatcttgaaatcctaaagcataaataaaggcaaaggaatcaa |
50573373 |
T |
|
| Q |
111 |
gtattacgagnnnnnnncacaaattgttgatgaaacaattccagtgaagtggataatctgaaagagaagaagttgtacctcaaatttagccggaaaacca |
210 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50573372 |
gtattacgagaaaaaaacacaaattgttgatgaaacaattccagtgaagtggataatctgaaagagaagaagttgtacctcaaatttagccggaaaacca |
50573273 |
T |
|
| Q |
211 |
agcttttgcatgataccggtc |
231 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
50573272 |
agcttttgcatgataccggtc |
50573252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 289 - 330
Target Start/End: Complemental strand, 50573177 - 50573136
Alignment:
| Q |
289 |
ggcttagttttccagtgtaattaacttcaagtggaggacatc |
330 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50573177 |
ggcttagttttccagtgtaattaacttcgagtggaggacatc |
50573136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 69 - 113
Target Start/End: Complemental strand, 50562138 - 50562094
Alignment:
| Q |
69 |
aatcttgaaatcctaaagcataaataaaggctaaggaatcaagta |
113 |
Q |
| |
|
||||| ||||||||||||||||| ||||| | ||||||||||||| |
|
|
| T |
50562138 |
aatctggaaatcctaaagcataagtaaagccgaaggaatcaagta |
50562094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 136 - 226
Target Start/End: Complemental strand, 50567514 - 50567427
Alignment:
| Q |
136 |
gttgatgaaacaattccagtgaagtggataatctgaaagagaagaagttgtacctcaaatttagccggaaaaccaagcttttgcatgatac |
226 |
Q |
| |
|
||||||||||||||| ||| ||| |||||| |||||||| ||| ||||||||| |||||| | ||||||||| |||||| ||||||| |
|
|
| T |
50567514 |
gttgatgaaacaatttcagcgaa---gataatatgaaagagtagatgttgtaccttaaatttgacgggaaaaccacacttttgtatgatac |
50567427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University