View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13469_high_23 (Length: 329)
Name: NF13469_high_23
Description: NF13469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13469_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 177 - 321
Target Start/End: Original strand, 49096545 - 49096689
Alignment:
| Q |
177 |
attaaggaagagtatagtcaatggaatattattggaatagtatattgatgattgaatgtgcatgatattgtaatttatgcaatgaaatgaaattagcatg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49096545 |
attaaggaagagtatagtcaatggaatattattggaatagtatattgattattgaatgtgcatgatattgtaatttatgcaatgaaatgaaattagcatg |
49096644 |
T |
|
| Q |
277 |
tgcgtgtgtcagattgagatttgttgaccggtgtgtgtctgtgct |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49096645 |
tgcgtgtgtcagattgagatttgttgaccggtgtgtgtctgtgct |
49096689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 51
Target Start/End: Original strand, 49096393 - 49096436
Alignment:
| Q |
5 |
cccatcacgatcaataaaatttattactaacttgtaatttgattgag |
51 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49096393 |
cccatcacgatcaataaaatttattac---cttgtaatttgattgag |
49096436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University