View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13469_high_24 (Length: 326)
Name: NF13469_high_24
Description: NF13469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13469_high_24 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 11 - 326
Target Start/End: Complemental strand, 48703335 - 48703020
Alignment:
| Q |
11 |
caaagggtaaagaatttgaaattgcaactgattatattctcagccacactttggaaaccatcctacagggttgtgatgtcgataatctctgtgcttttct |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48703335 |
caaagggtaaagaatttgaaattgcaactgattatattctcagccacactttggaaaccatcctacagggttgtgatgtcgataatctctgtgctttcct |
48703236 |
T |
|
| Q |
111 |
tcatagcagtgccaatcaattccccttcattgctatggatagatcaggttctcatgttgcccagactgccatcaactctctcgcttctcatcttcaatac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48703235 |
tcatagcagtgccaatcaattccccttcattgctatggatagatcaggttctcatgttgcccagactgccatcaactctctcgcttctcatcttcaatac |
48703136 |
T |
|
| Q |
211 |
gactacgaccaacatactcactctctcgttgaggaagctctaacccttatatgcaatgtcattgccgccaattctcttgatgttatgtgtaattgctacg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48703135 |
gactacgaccaacatactcactctctcgttgaggaagctctaacccttatatgcaatgtcattgccgccaattctcttgatgttatgtgtaattgctacg |
48703036 |
T |
|
| Q |
311 |
gctcccatgtgcttcg |
326 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
48703035 |
gctcccatgtgcttcg |
48703020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University