View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13469_high_25 (Length: 320)
Name: NF13469_high_25
Description: NF13469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13469_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 12 - 319
Target Start/End: Complemental strand, 18299023 - 18298710
Alignment:
| Q |
12 |
ataagatagggccatgatctttttgcgtcgcctaaaatatttgaatcaaatgttgttattggtttgtgttgtttcaaagctacc---gaaatcaannnnn |
108 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18299023 |
ataagatagggccatgatctttttgcgccgcctaaaatatttgaatcaaaggttgttattggtttgtgttgtttcaaagctaccttagaaatcaa-tttt |
18298925 |
T |
 |
| Q |
109 |
nnnaacaaaactacaagtttattatggttatggcatggtnnnnnnngatacacgcgtagtttgatacattaaatataatttattcatttgcatatttaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
18298924 |
tttaacaaaactacaagtttattatggttatggcatggt-aaaaaagatacacgcatagcttgatacatataatataatttattcatttgcgtatttaa- |
18298827 |
T |
 |
| Q |
209 |
ttattagactttacaaatgccacaaataattggtgttagtgctgcattaa--------atatcattgaaagccatcaccatatctaccgattatgtttct |
300 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| | ||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
18298826 |
--attagactttacaaacgccacaaataattggtgttagtgctgcatttagttctacgatatcattggaagccatcgctatatctaccgattatgtttct |
18298729 |
T |
 |
| Q |
301 |
cagattcggttatgtcttt |
319 |
Q |
| |
|
|| ||||| |||||||||| |
|
|
| T |
18298728 |
catattcgattatgtcttt |
18298710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University