View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13469_high_36 (Length: 305)
Name: NF13469_high_36
Description: NF13469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13469_high_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 57 - 296
Target Start/End: Original strand, 15307040 - 15307279
Alignment:
| Q |
57 |
tgtcaagtgtggttttagccaacaatcaaatatttggtcacggcttggcaaaattaatcgcgcattcaaaccgtgattttagtagaaatgataaaaaaga |
156 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
15307040 |
tgtcaagtgtggatttagccaacaatcaaatatttggtcacggcttggcaaaattaatcgcacattcaaaccgtgattttagtagaaatgataaaaaata |
15307139 |
T |
|
| Q |
157 |
gcttttacattggaatgaaaattttacattaacctttacatcagacttacgtttttgaataaacatccaaacatgattcacttaaattcgaagttcaaat |
256 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15307140 |
gcttttacattgggttgaaaattttacattaacctttacatcagacttgcgttttcgaataaacatccaaacatgattcacttaaattcgaagttcaaat |
15307239 |
T |
|
| Q |
257 |
tcaatttttgctatttaggttcataagccctctctctgct |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15307240 |
tcaatttttgctatttaggttcataagccctctctctgct |
15307279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 15306951 - 15307015
Alignment:
| Q |
1 |
gtagtgaggtccgttcttgtcacattgtgttttgttccaataattttactctcacatgtcaagtg |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15306951 |
gtagtgaggtccgttcttgtcacattgtgttttgttacaataattttactctcacatgtcaagtg |
15307015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University