View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1346_high_15 (Length: 289)
Name: NF1346_high_15
Description: NF1346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1346_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 67 - 239
Target Start/End: Complemental strand, 49903386 - 49903210
Alignment:
| Q |
67 |
atttatttggctatactacagcttgtaatctcatatcaaacacaataatagaatttccaacttgattggtacatgtgcaaagtgcaatgtgtccgaagga |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49903386 |
atttatttggctatactacagcttgtaatctcagatcaaacacaataatagaatttccaacttgattggtacatgtgcaaagtgcaatgtgtccgaagga |
49903287 |
T |
 |
| Q |
167 |
gcatggaaactgacactatttccattgggaaagaagtgagtagctatagct----tatctagctagtgtttttgttc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49903286 |
gcatggaaactgacactatttccattgggaaagaagtgagtagctatagcttatatatctagctagtgtttttgttc |
49903210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 68 - 99
Target Start/End: Original strand, 15991160 - 15991191
Alignment:
| Q |
68 |
tttatttggctatactacagcttgtaatctca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15991160 |
tttatttggctatactacagcttgtaatctca |
15991191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 68 - 99
Target Start/End: Complemental strand, 19847332 - 19847301
Alignment:
| Q |
68 |
tttatttggctatactacagcttgtaatctca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19847332 |
tttatttggctatactacagcttgtaatctca |
19847301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 88 - 144
Target Start/End: Original strand, 17749688 - 17749744
Alignment:
| Q |
88 |
cttgtaatctcatatcaaacacaataatagaatttccaacttgattggtacatgtgc |
144 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17749688 |
cttgtaatctcagatcaaacacaataatagaatttccaagttgattggtacatgtgc |
17749744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 67 - 113
Target Start/End: Complemental strand, 9845138 - 9845092
Alignment:
| Q |
67 |
atttatttggctatactacagcttgtaatctcatatcaaacacaata |
113 |
Q |
| |
|
|||| |||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9845138 |
atttgtttgcctatactacaacttgtaatctcatatcaaacacaata |
9845092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University