View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1346_high_20 (Length: 254)
Name: NF1346_high_20
Description: NF1346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1346_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 34101630 - 34101388
Alignment:
| Q |
1 |
gtttcatcagaacttccaacaacaacaacaggacatttgcaatggcgaacgcaatactcgcccccttccaacgataagcgcgctgaggttgagagtgttg |
100 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34101630 |
gtttcatcagaacttcccacaacaccaacaggacattcgcaatggcgaacgcaatactcgcccccttccaacgataagcgcgctgaggttgagactgttg |
34101531 |
T |
 |
| Q |
101 |
atctctaagcagagacgctccttgatttcatgatccatcacaatatggagattgtgaggaatctgtgcttgaagtaacggtttcgcaaaatcgttaagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
34101530 |
atctctaagcagagacgctccttgatttcatgatccatcacaatgtggagattgtaaggaatctgtgcttgaagtaacgatttcgcaaaatcgtcaagtt |
34101431 |
T |
 |
| Q |
201 |
tggaaatcgtgtacacgtggaagtagtttttcatcttcttcat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34101430 |
tggaaatcgtgtacacgtggaagtagtttttcatcttcttcat |
34101388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University