View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1346_high_8 (Length: 397)
Name: NF1346_high_8
Description: NF1346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1346_high_8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 30 - 397
Target Start/End: Original strand, 3915118 - 3915486
Alignment:
| Q |
30 |
tttcagttcgagcttcaatcatttactcaatttgctcgttttgttggtcttctgtaggaatctttcgtcaaacaaccttcagggtcccattccaattgaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3915118 |
tttcagttcgagcttcaatcatttactcaatttgctcgttttgttggtcttctgtaggaatctttcgtcaaacaaccttcagggtcccattccaattgaa |
3915217 |
T |
|
| Q |
130 |
ttgtcacggattggtaatttggatacattgtaagtatgaattattttgtagtttatctccttaagctcatatctttgattttatattaatagattatttc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3915218 |
ttgtcacggattggtaatttggatacattgtaagtatgaattattttgtagtttatctccttaagctcatatctttgattttatattaatagattatttc |
3915317 |
T |
|
| Q |
230 |
ttccagggatatttcaaacaacaaaatatctggaccaattccttcttcccttggtgacttggaacatcttctgaagctgtgagttatttgcttagttatt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3915318 |
ttccagggatatttcaaacaacaaaatatctggaccaattccttcttcccttggtgacttggaacatcttctgaagctgtgagttatttgcttagttatt |
3915417 |
T |
|
| Q |
330 |
atttcttggaatctttattg-tttcctatcactaattacgaattgtttgtactcattttgttaggaatc |
397 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3915418 |
atttcttggaatctttattgttttcctatcactaattacgaattgtttgtactcattttgttaggaatc |
3915486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University