View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1346_low_12 (Length: 409)
Name: NF1346_low_12
Description: NF1346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1346_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 66 - 323
Target Start/End: Complemental strand, 47151510 - 47151256
Alignment:
| Q |
66 |
gagatgaacaccttcacatctcttaaggaactcccaacaaattagatgatctttcaatccaagtcttcttatgataaaatcaataaaagaaagaggtgtt |
165 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47151510 |
gagaagaacaccttcacatctcttaagaaactcccaacaaattagatggtctttcaatccaagtcttcttatgataaaatcaataaaagaaagaggtgtt |
47151411 |
T |
 |
| Q |
166 |
gctggactcatcttccatccaagagttgaaagtatcaaaatttccatctttttaatcgtttttgcttcaaacaagtatctactctcttcaacctaaacaa |
265 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47151410 |
gctggattcatcttccatccaagagttgaaagtatcaaaatttccatctttttaatcgtttttgcttcaaacaagtatctactctcttcaacctaaacaa |
47151311 |
T |
 |
| Q |
266 |
aatttcaaaacaaattagtttagttctttttgtttcttgcaactttgcaagagttaag |
323 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47151310 |
aatttcaaaacaa---agtttagttctttttgtttcttgcaactttgcaagagttaag |
47151256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University