View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1346_low_13 (Length: 404)
Name: NF1346_low_13
Description: NF1346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1346_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 5e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 42 - 201
Target Start/End: Original strand, 38702878 - 38703037
Alignment:
| Q |
42 |
atgagttgctttcagcttattcagataatctctcaaggatagttgattataatttgattattatatctctaatctctaatggctaaaaaagtacaagttt |
141 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38702878 |
atgagttgctttcagcttattgagataatctctcaaggatagttgattataatttgattattatatctctaatctctaatggctaaaaaactacaagttt |
38702977 |
T |
|
| Q |
142 |
actttgaatgagaaaatagaatagatgttaggcatatttagattgtgaaacactaagata |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38702978 |
actttgaatgagaaaatagaatagatgttaggcctatttagattgtgaaacactaagata |
38703037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 103; Significance: 4e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 285 - 398
Target Start/End: Original strand, 11402866 - 11402980
Alignment:
| Q |
285 |
ctttgtcatgaccgcaaa-tggtctcaaatgatttttccaaatcatgacctctttatctccttttttgaggaaatgacctcttatctcatactcatatgg |
383 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11402866 |
ctttgtcatgaccgcaaaatggtctcaaatgatttttccaaatcatgacctctttatctccttttttgaggaaatgacctcttatctcatactcatatgg |
11402965 |
T |
|
| Q |
384 |
tgtgttctgtgttgc |
398 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
11402966 |
tgtgttctctgttgc |
11402980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University