View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1346_low_21 (Length: 330)
Name: NF1346_low_21
Description: NF1346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1346_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 322
Target Start/End: Original strand, 38899399 - 38899720
Alignment:
| Q |
1 |
ttttgctgataggagctgaagctgctgaatcacaaaacatgactcttgcttctgacataatcgaaaaactaaacaatgcctcgtctgtaggaaaaggcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38899399 |
ttttgctgataggagctgaagctgctgaatcacaaaacatgactcttgcttctgacataatcgaaaaactaaacaatgcctcgtctgtaggaaaaggcga |
38899498 |
T |
 |
| Q |
101 |
tagtttattgaacaggttgtgtcttttctttactcgaggattgtattataaaactacaaatgctcctaagttccattcagaacatgtttctacacagaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38899499 |
tagtttattgaacaggttgtgtcttttctttactcaaggattgtattataaaactacaaatgctcctaagttccattcagaacatgtttctacacagaca |
38899598 |
T |
 |
| Q |
201 |
agcacattctgtgtgtttcagatacttcaagaactctctccctatgtaaaatttgctcattttacagccaaccaggcaattttcgaagctacagctggtg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38899599 |
agcacattctgtgtgtttcagatacttcaagaactctctccctatgtaaaatttgctcattttacagccaaccaggcgattttcgaagctacagctggtg |
38899698 |
T |
 |
| Q |
301 |
ttgatgatgtccatctcattga |
322 |
Q |
| |
|
| || ||||| ||| ||||||| |
|
|
| T |
38899699 |
tcgaagatgttcatgtcattga |
38899720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University