View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1346_low_27 (Length: 272)
Name: NF1346_low_27
Description: NF1346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1346_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 67 - 166
Target Start/End: Original strand, 43184461 - 43184560
Alignment:
| Q |
67 |
ccaacctaaattgcaataattaatagcttaattaaaatacttatgattaggcaaatacacagtaagaaccgtgagtattttcaatatggttatggtgatg |
166 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43184461 |
ccaacctaaattgcaataattaatagcttgattaaaatacttatgattaggcaaatacacagtaagaaccgtgagtattttcaatatggttatggtgatg |
43184560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University