View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1346_low_27 (Length: 272)

Name: NF1346_low_27
Description: NF1346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1346_low_27
NF1346_low_27
[»] chr5 (1 HSPs)
chr5 (67-166)||(43184461-43184560)


Alignment Details
Target: chr5 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 67 - 166
Target Start/End: Original strand, 43184461 - 43184560
Alignment:
67 ccaacctaaattgcaataattaatagcttaattaaaatacttatgattaggcaaatacacagtaagaaccgtgagtattttcaatatggttatggtgatg 166  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43184461 ccaacctaaattgcaataattaatagcttgattaaaatacttatgattaggcaaatacacagtaagaaccgtgagtattttcaatatggttatggtgatg 43184560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University