View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1346_low_34 (Length: 251)
Name: NF1346_low_34
Description: NF1346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1346_low_34 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 88 - 251
Target Start/End: Complemental strand, 24579075 - 24578912
Alignment:
| Q |
88 |
cagcagcagcaaagtagtactcctaccaaaaaccaagagataatcaacaaagttttgccttctagctgtctttcaaaaacctctcaagagtcttcaaagg |
187 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
24579075 |
cagcagcagcaaagtagtactcataccaaaaaacaagagataatcaacaaagttttgccttctagctgtcttccaaaaacctctcaggagtcttcaaagg |
24578976 |
T |
|
| Q |
188 |
aagagaagactgaaatttctgaggtaattgatgtttctaacaataacaataacagtgcatgttc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24578975 |
aagagaagactgaaatttctgaggtaattgatgtttctaacagtaacaataacagtgcatgttc |
24578912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University