View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1346_low_43 (Length: 214)

Name: NF1346_low_43
Description: NF1346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1346_low_43
NF1346_low_43
[»] chr7 (2 HSPs)
chr7 (27-88)||(31069076-31069137)
chr7 (147-177)||(31069196-31069226)


Alignment Details
Target: chr7 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 27 - 88
Target Start/End: Original strand, 31069076 - 31069137
Alignment:
27 catttacccaaatctcaccccttttcattaaaaatccttttcaacccatttgttataatttc 88  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
31069076 catttacccaaatctcaccccttttcattaaaaacccttttcaacccatttgttataatttc 31069137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 177
Target Start/End: Original strand, 31069196 - 31069226
Alignment:
147 cactagatctcaatatcgaccaaacaataat 177  Q
    |||||||||||||||||||||||||||||||    
31069196 cactagatctcaatatcgaccaaacaataat 31069226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University