View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13470_high_3 (Length: 247)
Name: NF13470_high_3
Description: NF13470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13470_high_3 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 6 - 247
Target Start/End: Complemental strand, 3683605 - 3683364
Alignment:
| Q |
6 |
gagaggaaggaatggtgaatggtttttgcaatgaagttggtgttgatagaagtgttctcaaagtttggatgcataataataagaacactttgggaagaaa |
105 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3683605 |
gagatgaagaaatggtgaatggtttttgcaatgaagttggtgttgatagaagtgttctcaaagtttggatgcataataataagaacactttgggaagaaa |
3683506 |
T |
 |
| Q |
106 |
attatcattagatcatgttaatggtaatggtgacagcgccgccgtgaacgcctccgtggacggtggttctggtggtggttgtgagaatgagaataatggg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3683505 |
attatcattagatcatgttaatggtaatggtgacagcgccgccgtgaacgcctccgtggacggtggttctggtggtggttgtgagaatgagaataatggg |
3683406 |
T |
 |
| Q |
206 |
agtaatgttgctgcttgtggtactactaatgggtcttcttct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3683405 |
agtaatgttgctgcttgtggtactactaatgggtcttcttct |
3683364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 96
Target Start/End: Complemental strand, 2494316 - 2494249
Alignment:
| Q |
29 |
ttttgcaatgaagttggtgttgatagaagtgttctcaaagtttggatgcataataataagaacacttt |
96 |
Q |
| |
|
||||| |||||| ||||||||||| | |||||||| || |||||||||||||| || ||||||||||| |
|
|
| T |
2494316 |
ttttgtaatgaaattggtgttgatcgtagtgttcttaaggtttggatgcataacaacaagaacacttt |
2494249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University