View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13470_low_2 (Length: 309)

Name: NF13470_low_2
Description: NF13470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13470_low_2
NF13470_low_2
[»] chr6 (1 HSPs)
chr6 (19-245)||(3682895-3683118)


Alignment Details
Target: chr6 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 19 - 245
Target Start/End: Original strand, 3682895 - 3683118
Alignment:
19 aagagattaagacaaattaagtaataaataaataacaagcattcatttatcataacttctcataagaatgcactaaataatccgaagcttagtcgcgaga 118  Q
    ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||     || |||| |||||||||| |    
3682895 aagagattaagacaaattaagtaataaataaataacaagtattcaattatcataacttctcttaagaatgcacta-----tctgaagtttagtcgcgaaa 3682989  T
119 tattacaaaactagaatccaatccatttactactcgagttcgattgctttgtaaatatgaaatagtgaatac--nnnnnnnntgagattaagttgaaaaa 216  Q
    |||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||           | ||||||||| |||||    
3682990 tattacaaaactagaatccaatccatttaccactagagtttgattgctttgtaaatatgaaatagtgaatacgaaaaaaaaaagggattaagttaaaaaa 3683089  T
217 taaattaagaagttgatcatcacaatctc 245  Q
    |||||||||||||||||||||||||||||    
3683090 taaattaagaagttgatcatcacaatctc 3683118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University