View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13471_high_1 (Length: 369)
Name: NF13471_high_1
Description: NF13471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13471_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 54 - 363
Target Start/End: Complemental strand, 32006501 - 32006193
Alignment:
| Q |
54 |
cttttgttgcttcttcttaaaaggaaagaagctgcattttaatcggagaagcttcagttttaatttcgtcgagattccctttcttgtccagtggtaagct |
153 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||| |||||| |
|
|
| T |
32006501 |
cttttgctgcttcttcttcaaaggaaagaagctgcattttaatcggagaagcttcagttttaatttcgtcgagattcactttctcgttcagtgataagct |
32006402 |
T |
|
| Q |
154 |
ccatggcatcccatttcttgtccagattcactttcaatcaggctttcggtcttggccgtcgcccttgttgtatttgtcgtgcgaaacagttgcagtatca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32006401 |
ccatggcatcccatttcttgtccagattcactttcaatcaggctttcggtcttggccatcgcccttgttgtatttgtcgtgcgaaacagttgcagtatca |
32006302 |
T |
|
| Q |
254 |
taaaacgattgagttcttcggtggtgttctcgccatcccgccgtcgatgatattgaatggagannnnnnnccgattttgctctcctctctcttattccga |
353 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32006301 |
taaaatgattgagttcttcggcggtgttctcgccatcccgccgtcaatgatattgaatggaga-ttttttccgattttgctctcctctctcttattccga |
32006203 |
T |
|
| Q |
354 |
ttttcttcga |
363 |
Q |
| |
|
| || ||||| |
|
|
| T |
32006202 |
tcttgttcga |
32006193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University