View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13472_low_2 (Length: 271)
Name: NF13472_low_2
Description: NF13472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13472_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 254
Target Start/End: Original strand, 16901411 - 16901649
Alignment:
| Q |
18 |
acattagacaatgaagtttaacattgaaatatagagttgtttgttacacccaagacatgnnnnnnntaaa--ggaacataaagcaaaattggcacattgc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
16901411 |
acattagacaatgaagtttaacattgaaatatagagttgtttgttacacccaagacatgaaaaaaaaaaaagggaacataaagcaaaattggcacattgc |
16901510 |
T |
 |
| Q |
116 |
cattataacatcataacattacaactctatagaagaaacacaaactactaaaatgggtctaagatccaacgttttgaatgagttggattaccaaaacact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16901511 |
cattataacatcataacattacaactctatagaagaaacacatactactaaaatgggtctaagatccaacgttttgaatgagttggattaccgaaacact |
16901610 |
T |
 |
| Q |
216 |
catcatgataactttcatatacatttactttggcctttg |
254 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16901611 |
catcatgataactttcatatacatgtactttggcctttg |
16901649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University