View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13475_high_10 (Length: 278)
Name: NF13475_high_10
Description: NF13475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13475_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 264
Target Start/End: Original strand, 47126314 - 47126565
Alignment:
| Q |
17 |
atgtttggatcgtgtcggacaccaaac----cttcaatctaaagtgtcggtgatacatagtttattcgataccaaagctaagtctttggttagataaata |
112 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47126314 |
atgtttggatcgtgtcgaacaccaaacacaccttcaatctaaagtgtcggtgatacatagtttattcgacaccaaagctaagtctttggttagataaata |
47126413 |
T |
|
| Q |
113 |
gcaagaattcaaagagaatggtttcagatggatatgctgttgggaattcccttaccagtgagtccaccctccctagaataatcagaggtattgggaaaca |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126414 |
gcaaaaattcaaagagaatggtttcagatggatatgctgttgggaattcccttaccagtgagtccaccctccctagaataatcagaggtattgggaaaca |
47126513 |
T |
|
| Q |
213 |
gaagggtatatggcaatttcactggcccatttctgttcttcaaacttgggtc |
264 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126514 |
gaagggtataaggcaatttcactggcccatttctgttcttcaaacttgggtc |
47126565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University