View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13475_low_12 (Length: 270)
Name: NF13475_low_12
Description: NF13475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13475_low_12 |
 | |
|
| [»] scaffold0170 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0170 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 14 - 262
Target Start/End: Original strand, 10224 - 10472
Alignment:
| Q |
14 |
caagtacaacaataccaaacccacaagtgaacaaaaaacccacaatgaaaacaaagagaacggcgaaaaccggaaccaatattgggcttaaaaagatgat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10224 |
caagtacaacaataccaaacccacaagtgaacaaaaagcccacaatgaaaacaaagagaacggcgaaaaccggaaccaatattgggcttaacaagatgat |
10323 |
T |
|
| Q |
114 |
cattggcgcaaagaggataaaacccatgatggttactacgaatgttaggcatgtgagaaagagagaaatggtgctaactatgaaaagggtgaagaggcca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10324 |
cattggcgcaaagaggataaaacccatgatggttactacgaatgttaggcatgtgagaaagagagaaatggtgcaaactatgaaaagggtgaagaggcca |
10423 |
T |
|
| Q |
214 |
aagagttgggttgagtttgaaacatgtttccttatcaatggtgatgatg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10424 |
aagagttgggttgagtttgaaacatgtttccttagcaatggtgatgatg |
10472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University