View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13475_low_13 (Length: 265)
Name: NF13475_low_13
Description: NF13475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13475_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 28250435 - 28250323
Alignment:
| Q |
1 |
gctggtgtgaacgtgaaagctactggtgtttttactgttgcagtgactgctttgtctgcatttgttgtttcgtttgttttcatgtcttgatttgtaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28250435 |
gctggtgtgaacgtgaaagctactggtgtttttactgttgcagtgactgctttgtctgcttttgttgtttcgtttgttttcatgtcttgatttgtaattt |
28250336 |
T |
|
| Q |
101 |
cagagtgttcttg |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28250335 |
cagagtgttcttg |
28250323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 228 - 257
Target Start/End: Complemental strand, 28250208 - 28250179
Alignment:
| Q |
228 |
ggtatggaccgttgtaagtgaatgatgatg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28250208 |
ggtatggaccgttgtaagtgaatgatgatg |
28250179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University