View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13476_high_8 (Length: 342)
Name: NF13476_high_8
Description: NF13476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13476_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 336
Target Start/End: Complemental strand, 33252499 - 33252188
Alignment:
| Q |
18 |
gggaggatgacagtagttgctcaaaggggatgatgtttttgcaaatactcttgcggtcaaattagtttgtgatcaaatgtgtggaactttaagggttaga |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
33252499 |
gggaggatgacaatagttgctcaaaggggatgatgtttctgcaaatactcttgcggtcaaattagtttgtgatcaaatgtgtggaattttaagggttaaa |
33252400 |
T |
|
| Q |
118 |
agtagtgcacctttaacttgcattaggttttcatgtggtttcgaggtgaaatatgtcgagtctgttgaattgtatcaagttttattaatggatcattgtc |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
33252399 |
agtaatgcacctttaacttgcattaggttttcatgtggtttcgaggtgaaatatgttgagcctgttgaattgtatcaagttttatta-------attgtc |
33252307 |
T |
|
| Q |
218 |
cgattgtcattgattaacgccagcgagaccactgaactcgtttaagtgtgccggtgttacatcatcctaacatgttgagaagcgacccaatcttttagct |
317 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33252306 |
cgattgtcattgattgacgccagcgagaccactaaactcgtttaagtgtgccggtgttacatcatcctaacatgttgagaagcgacccaatcttttagct |
33252207 |
T |
|
| Q |
318 |
tattgggcttagtccaacc |
336 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33252206 |
tattgggcttagtccaacc |
33252188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University