View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13476_low_11 (Length: 256)
Name: NF13476_low_11
Description: NF13476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13476_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 252
Target Start/End: Original strand, 40709002 - 40709234
Alignment:
| Q |
20 |
cagccaccaaccaaatcgtttgctgtcgctttggcaggacataatgtgaccgacgaacggcccttccaacaccttgcatcaaaggtgatgcgttgagcat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40709002 |
cagccaccaaccaaatcgtttgctgtcgctttagcaggacataatgtgaccgacgaacggcccttccaacaccttgcatcaaaggtgatgcgttgagcat |
40709101 |
T |
|
| Q |
120 |
acgtatttgtcaggacgagtacacaaagggggttgatgattgcaagaatgccttacgagccaggttaacgttaaacaagggggataaggccaggccgtga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40709102 |
acgtatttgtcaggacgagtacacaaagggggttgatgattgcaagaatgccttacgagccaggttaacgttaaacaagggggataaggccaggccgtga |
40709201 |
T |
|
| Q |
220 |
gcctatagtccggcctacttaaagtccgactcg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40709202 |
gcctatagtccggcctacttaaagtccgactcg |
40709234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University