View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13477_high_1 (Length: 418)
Name: NF13477_high_1
Description: NF13477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13477_high_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 26 - 405
Target Start/End: Original strand, 30948528 - 30948908
Alignment:
| Q |
26 |
gtgtctgataccgacatggtcgtcttcaatctgaagtttcagtcttatagagataatcaaacttttaagctagactgaactcattctttgtagggatggg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30948528 |
gtgtctgataccgacatggtcgtcttcaatctgaagtttcagtcttatagagataatcaaacttttaagctagactgaactcattctttgtagggatggg |
30948627 |
T |
|
| Q |
126 |
acaattccttgcatcacccttttgctaggtggcaacc-ttacacaaggtatatgaaatttaactttgaaagacttaactcattcttctcaacattcttta |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30948628 |
acaattccttgcatcacccttttgctaggtggcaacccttacacaaggtatatgaaatttaactttgaaagacttaactcattcttctcaacattcttta |
30948727 |
T |
|
| Q |
225 |
aaaacagtctgaataactaatgttannnnnnnaatgtcctgaaattgcaggaatgcgatcatcaagtatcaaaccattggtcctcattagtatcatcatt |
324 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30948728 |
aaaacagtctgaataactaatgttattattttaatgtcctgaaattgcaggaatgcgatcatcaagtatcaaaccattggtcctcattagtatcatcatt |
30948827 |
T |
|
| Q |
325 |
gttaaacttttcttactacctgttattggattttttgttgttaaagcggctgcaaatttaggcttcctcccactagaccct |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30948828 |
gttaaacttttcttactacctgttattggattttttgttgttaaagctgctgcaaatttaggcttcctcccactagaccct |
30948908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University