View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13477_low_3 (Length: 261)

Name: NF13477_low_3
Description: NF13477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13477_low_3
NF13477_low_3
[»] chr8 (1 HSPs)
chr8 (17-243)||(2777785-2778011)


Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 2778011 - 2777785
Alignment:
17 tagttagaatcagtttgaaggtaagaaaacgatttgaattgaaaaatactcggaggaggagtgaaagtgatattgattgagattaagaagataaaagaga 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
2778011 tagttagaatcagtttgaaggtaagaaaacgatttgaattgaaaaatactcggaggaggagtgaaagtgatatcgattgagattaagaagataaaagaga 2777912  T
117 attgaagtgtaattaataacgcaaaattgagaatagagaaaacctgatctttatccagtttggcgggggatgccatggtcgttggtgaagaagactgagg 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2777911 attgaagtgtaattaataacgcaaaattgagaatagagaaaacctgatctttatccagtttggcgggggatgccatggtcgttggtgaagaagactgagg 2777812  T
217 gagaggacggacccaaaatggggatgg 243  Q
    ||||||| |||||||||||||||||||    
2777811 gagaggaaggacccaaaatggggatgg 2777785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University