View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13477_low_3 (Length: 261)
Name: NF13477_low_3
Description: NF13477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13477_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 2778011 - 2777785
Alignment:
| Q |
17 |
tagttagaatcagtttgaaggtaagaaaacgatttgaattgaaaaatactcggaggaggagtgaaagtgatattgattgagattaagaagataaaagaga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2778011 |
tagttagaatcagtttgaaggtaagaaaacgatttgaattgaaaaatactcggaggaggagtgaaagtgatatcgattgagattaagaagataaaagaga |
2777912 |
T |
|
| Q |
117 |
attgaagtgtaattaataacgcaaaattgagaatagagaaaacctgatctttatccagtttggcgggggatgccatggtcgttggtgaagaagactgagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2777911 |
attgaagtgtaattaataacgcaaaattgagaatagagaaaacctgatctttatccagtttggcgggggatgccatggtcgttggtgaagaagactgagg |
2777812 |
T |
|
| Q |
217 |
gagaggacggacccaaaatggggatgg |
243 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
2777811 |
gagaggaaggacccaaaatggggatgg |
2777785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University