View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13478_high_10 (Length: 282)
Name: NF13478_high_10
Description: NF13478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13478_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 13 - 264
Target Start/End: Complemental strand, 37005068 - 37004817
Alignment:
| Q |
13 |
aatatgtccaggtttgatatcagttctggtacccatatgcttgaactttgcttcaaaatgttcatggagaaattctttgcctgcatgaagtttactatat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37005068 |
aatatgtccaggtttgatatcagttctggtacccatatgcttgaactttgcttcaaaatgttcatggagaaactctttgcctgcatgaagtttactatat |
37004969 |
T |
 |
| Q |
113 |
gctttagaactactacatgatcaaaataaatgctaattgttgtgtgatgaatctatttatatcactgtatttctattgtggattaggcctctcaatatta |
212 |
Q |
| |
|
| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37004968 |
gttttagaactactaattgatcaaaataaatgctaattgttgtgtgatgaatctatttatatcactgtatttctattgtggattaggcctctcaatatta |
37004869 |
T |
 |
| Q |
213 |
tgaaatattttatgaactgataattaaaattggtcaaaccaagcacgttttc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37004868 |
tgaaatattttatgaactgataattaaaattggtcaaaccaagcacgttttc |
37004817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University