View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13478_high_11 (Length: 276)

Name: NF13478_high_11
Description: NF13478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13478_high_11
NF13478_high_11
[»] chr8 (2 HSPs)
chr8 (188-259)||(40577329-40577400)
chr8 (23-80)||(40577161-40577221)


Alignment Details
Target: chr8 (Bit Score: 72; Significance: 8e-33; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 188 - 259
Target Start/End: Original strand, 40577329 - 40577400
Alignment:
188 cagttctcttgtaaacatattctactaatttatcagtttcaagtactcctttcactgtcactagtgagttct 259  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40577329 cagttctcttgtaaacatattctactaatttatcagtttcaagtactcctttcactgtcactagtgagttct 40577400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 23 - 80
Target Start/End: Original strand, 40577161 - 40577221
Alignment:
23 ttggttttccatctccttctgcag---cagcagcttctttcttttcctcgacttcaccact 80  Q
    ||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||    
40577161 ttggttttccatctccttctgcagcagcagcagcttctttcttttcctcgacttcaccact 40577221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University