View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13478_high_11 (Length: 276)
Name: NF13478_high_11
Description: NF13478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13478_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 8e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 188 - 259
Target Start/End: Original strand, 40577329 - 40577400
Alignment:
| Q |
188 |
cagttctcttgtaaacatattctactaatttatcagtttcaagtactcctttcactgtcactagtgagttct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40577329 |
cagttctcttgtaaacatattctactaatttatcagtttcaagtactcctttcactgtcactagtgagttct |
40577400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 23 - 80
Target Start/End: Original strand, 40577161 - 40577221
Alignment:
| Q |
23 |
ttggttttccatctccttctgcag---cagcagcttctttcttttcctcgacttcaccact |
80 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40577161 |
ttggttttccatctccttctgcagcagcagcagcttctttcttttcctcgacttcaccact |
40577221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University