View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13478_low_12 (Length: 263)
Name: NF13478_low_12
Description: NF13478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13478_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 247
Target Start/End: Complemental strand, 26427731 - 26427500
Alignment:
| Q |
17 |
cacagaggttttagagaaaaaatatagtgcatgcttcaatttcctgactggtgtttgtataccatataatttttt--gaatgcctttgcagaaccggtca |
114 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
26427731 |
cacagaggttttagagaaaaa-tatagtgcatgcttcaatttcctgactggtgtttgtataccatataattttttttgcatgcctttgcagaaccggtca |
26427633 |
T |
 |
| Q |
115 |
ttattaactgctgctgaaagtaaacttgcagaagcaagaaatcaatacgatcaaatggtagagaataagcagttggaattgtcaaagcatttaaaagaaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26427632 |
ttattaactgctgctgaaagtaaacttgcagaagctagaaatcaatacgatcaaatggtagagaataagcagttggaattgtcaaagcatttaaaagaaa |
26427533 |
T |
 |
| Q |
215 |
tatctcaaagaaatgatcaggtgttgcatataa |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26427532 |
tatctcaaagaaatgatcaggtgttgcatataa |
26427500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University