View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13479_low_2 (Length: 364)
Name: NF13479_low_2
Description: NF13479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13479_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 19 - 354
Target Start/End: Original strand, 51455169 - 51455504
Alignment:
| Q |
19 |
ctacctaccatctctttctattttcttttattcaatttctcaattattatgttttaattcaccgccttcgtcgtcgtcgtttagattattgagcttccaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51455169 |
ctacctaccatctctttctattttcttttattcaatttctcaattattatgttttaattcaccgccttcgtcgtcgtcgtttagattattgagcttccaa |
51455268 |
T |
 |
| Q |
119 |
tcgtcatccttctctacagtcgctatcgacacaatccccaacaatcttcggtaatgcattgtatacctcttccttaatttgtcttcttcttgtcgatagt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||| | |
|
|
| T |
51455269 |
tcgtcatccttctctacagtcgctatcgacacaatccccaacaatcctcggtaatgcattgtatgcctcttccttaatttttcttcttcttgtcgataat |
51455368 |
T |
 |
| Q |
219 |
attctttagtttgattatgatttatgtatgttctatgcagtacctacgagctgttgccagaggcattctaggactcccagcaggttacttcaatttctct |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51455369 |
attctttagtttgattatgatttatgtatgttctatgtagtacctacgagctgttgccagaggcattctaggactcccagcaggttagttcaatttctct |
51455468 |
T |
 |
| Q |
319 |
tttgatgtgatttatgaatattattccgtgtttcat |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
51455469 |
tttgatgtgatttatgaatattattccgtgtttcat |
51455504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University