View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13479_low_8 (Length: 217)

Name: NF13479_low_8
Description: NF13479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13479_low_8
NF13479_low_8
[»] chr8 (1 HSPs)
chr8 (1-201)||(36938238-36938438)


Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 36938238 - 36938438
Alignment:
1 atgaaacgacgccgtttttgtcgaggtagattgatttaacgtcggaggggtgaccgagcatggtgaaaacgacgtcggaggaattagcgagatgggaagg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
36938238 atgaaacgacgccgtttttgtcgaggtagattgatttaacgtcggaggggtgaccgagcatggtgaaaacgacgtcggaggagttagcgagatgggaagg 36938337  T
101 tgaatttgcgagtttggcaccgagggattgaagagagagggaatttgggtgggatgggttgcgagcgtagaaggtgagagtgtaaccggcggagatgagg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36938338 tgaatttgcgagtttggcaccgagggattgaagagagagggaatttgggtgggatgggttgcgagcgtagaaggtgagagtgtaaccggcggagatgagg 36938437  T
201 c 201  Q
    |    
36938438 c 36938438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University